View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17469_high_22 (Length: 212)
Name: NF17469_high_22
Description: NF17469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17469_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 3567405 - 3567598
Alignment:
| Q |
1 |
actgcatcggcacaatttattacggtgcctcaaaaatcatttggggttgtgttagggtgcagcaatccatcgcactaggaggaggctcctttaccggttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3567405 |
actgcatcggcacaatttattacggtgcctcaaaaatcatttggggttgtgttagggtgcagcaatccatcgcactaggaggaggctcctttactggttc |
3567504 |
T |
 |
| Q |
101 |
cctgcatcaaaggggatgcactttccattaggattgaacaggaagactattctaagggtttagttgaatgtcaaaatgctctaaggggtcgttt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3567505 |
cctgcatcaaaggggatgcactttccattaggattgaacaggaagactattctaagggtttagttgaatgtcaaaatgctctaaggggtcgttt |
3567598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University