View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17469_high_7 (Length: 408)
Name: NF17469_high_7
Description: NF17469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17469_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 16 - 392
Target Start/End: Complemental strand, 25306519 - 25306125
Alignment:
| Q |
16 |
aatatttaaatccaatttcacattttttgttatgaaattcaagttgatctcttaaactttctctccaatctttctagtgatcgagtggtggttattttca |
115 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25306519 |
aatatttaattccaatttcacattgtttgttatgaaattcaagttgatctcttaaactttctctccaatctttctagtgatcgagtggtggttattttca |
25306420 |
T |
 |
| Q |
116 |
ctacacccatttaggtccnnnnnnnnnatcactagatactaagcttataattattgacattcagtgtgcaattcatcttcttgattggttt--------- |
206 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25306419 |
ctacgcccatttaggtcctttttttt-atcactagatactaagcttataattattgacattcagtgtgcaattcatcttcttgattggttttttattcaa |
25306321 |
T |
 |
| Q |
207 |
----------aaaatcaatcttgatgacttaacgctcactgacgatgaagggttgtgttttgaactagaggaagagagtgaggtagggaattatccgaat |
296 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25306320 |
aattgtgtttaaaatcaatcttgatgacttaacgcttactgacgatgaagggctgtgttttgaactagaggaagagagtgaggtagggaattatccgaat |
25306221 |
T |
 |
| Q |
297 |
ttgtgtttggtgagccgttttccggtgaatcaaccctttaagatgaaacccatgaaggtgtgtatgcctgaagtgtggcggctgatgaaggttgtg |
392 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25306220 |
ttgtgtttggtgaggcgttttccggtgaatcaaccctttaagatgaaacccatgaaggtgtgtatgcctgaagtgtggcggatgatgaaggttgtg |
25306125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University