View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17469_low_17 (Length: 308)

Name: NF17469_low_17
Description: NF17469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17469_low_17
NF17469_low_17
[»] chr2 (2 HSPs)
chr2 (171-308)||(8926195-8926340)
chr2 (31-114)||(8926393-8926476)
[»] chr4 (1 HSPs)
chr4 (32-108)||(55523146-55523222)
[»] chr5 (1 HSPs)
chr5 (1-35)||(15502743-15502777)


Alignment Details
Target: chr2 (Bit Score: 109; Significance: 8e-55; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 109; E-Value: 8e-55
Query Start/End: Original strand, 171 - 308
Target Start/End: Complemental strand, 8926340 - 8926195
Alignment:
171 tatatatgcatgtttagaatcagagtgaacttaacgaggtgacacgacacatcgtgattctgtcaagttcaccgttaatctaaacatgcac--------a 262  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |    
8926340 tatatatgcatgtttagaatcaaagtgaacttaacgaggtgacacgacacatcgtgattctgtcaagttcaccgttaatctaaacatgcactgtattaaa 8926241  T
263 gagaaattttgatgatgtatagaactagcacctcaaagaagcccca 308  Q
    |||||||||||||||||||||||||||| |||||||||||||||||    
8926240 gagaaattttgatgatgtatagaactagtacctcaaagaagcccca 8926195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 31 - 114
Target Start/End: Complemental strand, 8926476 - 8926393
Alignment:
31 ttccatacactgcttgtagtgttcttttgtgagcttctccactttgtccatcaactcaatagatatactatggttcacacactt 114  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8926476 ttccatacacttcttgtagtgttcttttgtgagcttctccactttgtccatcaactcaatagatatactatggttcacacactt 8926393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 32 - 108
Target Start/End: Complemental strand, 55523222 - 55523146
Alignment:
32 tccatacactgcttgtagtgttcttttgtgagcttctccactttgtccatcaactcaatagatatactatggttcac 108  Q
    ||||||| || |||||||| ||||||||| |||||||| ||||||||||| ||||| || ||||| | |||||||||    
55523222 tccatacgcttcttgtagttttcttttgtcagcttctcaactttgtccatgaactctatggatatcccatggttcac 55523146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 15502743 - 15502777
Alignment:
1 tatgaatcaatagaaagaaatgcgcaaagattcca 35  Q
    ||||||||||||||||||||||| |||||||||||    
15502743 tatgaatcaatagaaagaaatgctcaaagattcca 15502777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University