View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17469_low_22 (Length: 226)
Name: NF17469_low_22
Description: NF17469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17469_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 16 - 208
Target Start/End: Complemental strand, 55670895 - 55670703
Alignment:
| Q |
16 |
aagaagattgatgttggtcctcaattcactttgaaagagcaactcgaaaaggataaggttcacnnnnnnnnnnnnnnnnnnnnncttcgaaaaatatcca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55670895 |
aagaagattgatgttggtcctcaattcactttgaaagagcaactcgaaaaggataaggttcacttttctttttgatgtttttttcttcgaaaaatatcca |
55670796 |
T |
 |
| Q |
116 |
tgctttgttctcatgttaattaatcatttatgcatttgttaattgttttcttcctgagtccttaggatgatgagagcttgaggaagtggaagg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55670795 |
tgctttgttctcatgttaattaatcatttatgcatttgttaattgttttcttcctgagtccttaggatgatgagagcttgaggaagtggaagg |
55670703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University