View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1746_high_8 (Length: 300)
Name: NF1746_high_8
Description: NF1746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1746_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 28 - 156
Target Start/End: Complemental strand, 30683999 - 30683871
Alignment:
| Q |
28 |
ggatccaattgtagcttctcctttatatgaaatcataggcgcaagatctacaacttctccaatagattgtaatattatctgccgacatgataaataacca |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30683999 |
ggatccaattgtagcttctcctttatatgaaatcataggcgcaagatctacaacttctccaatagattgtaatattatctgccgacatgataaataacca |
30683900 |
T |
 |
| Q |
128 |
acagaacatcaatcccagatttcctcaag |
156 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30683899 |
acagaacatcaatcccagatttcctcaag |
30683871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 194 - 281
Target Start/End: Complemental strand, 30683833 - 30683746
Alignment:
| Q |
194 |
gattaattttctagtttaaatattctttgtatttagttagttacagcagtgaagtttaactctctctagctagtgtaggttaaacaca |
281 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30683833 |
gattaattttctagtttaaatattctttgcatttagttagttacagtagtgaagtttaactctctccagctagtgtaggttaaacaca |
30683746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University