View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17471_high_3 (Length: 237)
Name: NF17471_high_3
Description: NF17471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17471_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 218
Target Start/End: Complemental strand, 46847649 - 46847446
Alignment:
| Q |
15 |
agcagagattcttatgaaaaatatggaaatggagccggatggagctatttggggttctcttcttagtgcttgtaaggttcatggacgcgttgagttcggt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46847649 |
agcagagattcttatgaaaaatatggaaatggagccggatggagctatttggggttctcttcttagtgcttgtaaggctcatggacgcgttgagttcggt |
46847550 |
T |
|
| Q |
115 |
gaatatgtagcagaacgcctctttcaattagagccagaaaatgcaggggcatttgtgcttctgtcaaatatatatgcaggagctggtagatgggacgatg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46847549 |
gaatatgtagcagaacgcctctttcaattagagccagaaaatgcaggggcatttgtgcttctgtcaaatatatatgcaggagctggtagatgggacgatg |
46847450 |
T |
|
| Q |
215 |
tagc |
218 |
Q |
| |
|
|||| |
|
|
| T |
46847449 |
tagc |
46847446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University