View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17471_low_1 (Length: 319)
Name: NF17471_low_1
Description: NF17471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17471_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 141 - 303
Target Start/End: Original strand, 49138288 - 49138451
Alignment:
| Q |
141 |
gcatatgatctctgcatagtttatggtatcttacacaacaaaaacttgtgagtttttgtgaccaagcaaaaggagatcaatttccacg-aaaacagtaat |
239 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
49138288 |
gcatatgatctctgcacagtttatggtatcttacacaacaaaaacttgtgaattgttgtgaccaagtaaaaggagatcaatttccacgaaaaacagtaat |
49138387 |
T |
 |
| Q |
240 |
gagttgcatctgcatcttaaatggtcaaaactcaaaagcaatatgccctcgacggttttgttgg |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49138388 |
gagttgcatctgcatcttaaatggtcaaaactcaaaagcaatatgccctggacggttttgttgg |
49138451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 1 - 150
Target Start/End: Original strand, 49137777 - 49137926
Alignment:
| Q |
1 |
ccatgttcctcatgtcctttttaaatttatttttctaaaaatgtctgctgacccttacattgtttcaacgaataagtattttattgtctattcattttac |
100 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49137777 |
ccatgttcctcatgtcgtttttaattttatttttctagaaatgcctgctgacacttacattgtttcaacgaataagtattttattgtttattcattttac |
49137876 |
T |
 |
| Q |
101 |
ttgagctgttttcagcaaatatttcatcggttgttggttggcatatgatc |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49137877 |
ttgagctgttttcagcaaatatttcatcggttgttggttggcatatgatc |
49137926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University