View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17471_low_4 (Length: 201)
Name: NF17471_low_4
Description: NF17471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17471_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 6 - 183
Target Start/End: Original strand, 25755060 - 25755237
Alignment:
| Q |
6 |
gagtgagatgaagaaaaagattgagactttggataggattactactattcttaaagatgttattcataataaggtaatttgctcctattattgttctcat |
105 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25755060 |
gagtgaaatggagaaaaagattgagactttggataggattactactattcttaaagatgttattcataataaggtaatttgctcctattattgttctcat |
25755159 |
T |
 |
| Q |
106 |
ttttcagttgttgattaattttcttagcagttattatgtgatatgtgatttagtacaagtattgttatatgacgtaac |
183 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25755160 |
ttttcagttgttggttaattttcttagcagttattatgtgatatgtgatttagtacaagtattgttatatgacgtaac |
25755237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 6 - 81
Target Start/End: Original strand, 46380300 - 46380375
Alignment:
| Q |
6 |
gagtgagatgaagaaaaagattgagactttggataggattactactattcttaaagatgttattcataataaggta |
81 |
Q |
| |
|
|||||| ||| |||||||||||||||| ||| ||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
46380300 |
gagtgaaatggagaaaaagattgagacgttgtcaaggattactactattctcaaagatgttattcagaataaggta |
46380375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University