View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17472_high_4 (Length: 276)
Name: NF17472_high_4
Description: NF17472
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17472_high_4 |
 |  |
|
| [»] scaffold0332 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0522 (1 HSPs) |
 |  |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 5e-31; HSPs: 16)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 13 - 89
Target Start/End: Original strand, 30129100 - 30129176
Alignment:
| Q |
13 |
aatataacattaaagatccatttgaattgacttttttgaacttatctactaagctacacccttgtatagatgtttga |
89 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30129100 |
aatataacattaaggattcatttgaattgacttttttgaacttatctactaagctacacccttgtatagatgtttga |
30129176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 86 - 161
Target Start/End: Original strand, 30129228 - 30129305
Alignment:
| Q |
86 |
ttgattactc--attcttttctgaaaactcggtgatagattcaatctgttgtttcaccttttatgtcacttcctcttt |
161 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30129228 |
ttgattactcgtattcttttctgaaaactcggtgatagattcaatctgttgtttcaccttttatgtcacttcctcttt |
30129305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 162 - 213
Target Start/End: Original strand, 30129337 - 30129388
Alignment:
| Q |
162 |
aatcacaggggcataaacaatattggaactgaacttcaaatgttgcaccaac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30129337 |
aatcacaggggcataaacaatattggaactgaacttcaaatgttgcaccaac |
30129388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 14228721 - 14228767
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||| ||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
14228721 |
gtacaactattttgtgataacttttgtacaactttctctctcatact |
14228767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 28623168 - 28623122
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
28623168 |
gtacaaccattatgtgataactttttgacaactttctctttcatact |
28623122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 30129429 - 30129475
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||| |||||| |
|
|
| T |
30129429 |
gtacaaccattatttgacaacttttgaacaactttctctcgcatact |
30129475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 230 - 260
Target Start/End: Complemental strand, 1158376 - 1158346
Alignment:
| Q |
230 |
ataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1158376 |
ataacttttgaacaactttctctctcatact |
1158346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 2597216 - 2597171
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
2597216 |
gtacaaccattatgtgataatttttggacaac-ttctctctcatact |
2597171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 7129547 - 7129593
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||||||||||| |||||| |
|
|
| T |
7129547 |
gtacaaccattttgtgacaacttttggacaactttctctcacatact |
7129593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 21648988 - 21648942
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||| | ||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
21648988 |
gtacaaccaatttgtgacaactttttaacaactttctctctcatact |
21648942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 32185718 - 32185672
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||| | ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
32185718 |
gtacaaccaatttgtgacaacttttgtacaactttctctctcatact |
32185672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 32674289 - 32674243
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| || |||||||||| |||||||||||||||||||| |
|
|
| T |
32674289 |
gtacaaccattttggtataacttttgtacaactttctctctcatact |
32674243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 37562198 - 37562152
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||| ||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
37562198 |
gtacaactattatgtgacaacttttagacaactttctctctcatact |
37562152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 44380671 - 44380625
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| ||| ||| ||||||||||||||||||||| |
|
|
| T |
44380671 |
gtacaaccattttgtgacaacctttaaacaactttctctctcatact |
44380625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 260
Target Start/End: Complemental strand, 41293777 - 41293732
Alignment:
| Q |
215 |
tacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
|||||||| | ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
41293777 |
tacaaccaatttgtgacaacttttgtacaactttctctctcatact |
41293732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 232 - 260
Target Start/End: Original strand, 7376538 - 7376566
Alignment:
| Q |
232 |
aacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7376538 |
aacttttgaacaactttctctctcatact |
7376566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 15)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 39788763 - 39788717
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
39788763 |
gtacaaccattatgtgacaacttttggacaactttctctctcatact |
39788717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 7144591 - 7144637
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
7144591 |
gtacaaccattttatgataacttttaaacaactttctctctcatact |
7144637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 258
Target Start/End: Original strand, 19437271 - 19437315
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcata |
258 |
Q |
| |
|
||||||||||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
19437271 |
gtacaaccattttgtgataacctttaaacaactttctctctcata |
19437315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 8959174 - 8959220
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||| ||||||||| |||||||| |||||| ||||||||||||| |
|
|
| T |
8959174 |
gtacaactattatgtgacaacttttggacaactgtctctctcatact |
8959220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 9594492 - 9594538
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||| | ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
9594492 |
gtacaaccaatttgtgacaacttttgtacaactttctctctcatact |
9594538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 9599785 - 9599739
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||| | ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
9599785 |
gtacaaccaatttgtgacaacttttgtacaactttctctctcatact |
9599739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 26685553 - 26685507
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| |||||||||| || ||||||||||||||| |
|
|
| T |
26685553 |
gtacaaccattttgtgacaacttttgaataattttctctctcatact |
26685507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 26955284 - 26955238
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| |||||||||| || ||||||||||||||| |
|
|
| T |
26955284 |
gtacaaccattttgtgacaacttttgaataattttctctctcatact |
26955238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 27440493 - 27440539
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
|||||| |||| ||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
27440493 |
gtacaatcattttgtgacaacttttgaacaattttctctctcatact |
27440539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 30574434 - 30574388
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||| | ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
30574434 |
gtacaaccaatttgtgacaacttttgtacaactttctctctcatact |
30574388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 35814467 - 35814513
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||||| ||||||||| |
|
|
| T |
35814467 |
gtacaaccattttgtgataactttggtacaactttctttctcatact |
35814513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 260
Target Start/End: Complemental strand, 582923 - 582878
Alignment:
| Q |
215 |
tacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
|||||| ||| ||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
582923 |
tacaactattttgtgataacttttaaacaattttctctctcatact |
582878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 3154700 - 3154656
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcata |
258 |
Q |
| |
|
||||||| ||| | |||||||||||| |||||||||||||||||| |
|
|
| T |
3154700 |
gtacaactattttatgataacttttgtacaactttctctctcata |
3154656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 258
Target Start/End: Original strand, 28501631 - 28501675
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcata |
258 |
Q |
| |
|
||||||||||| ||||| || ||||| |||||||||||||||||| |
|
|
| T |
28501631 |
gtacaaccattttgtgacaatttttgtacaactttctctctcata |
28501675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 232 - 260
Target Start/End: Complemental strand, 32379968 - 32379940
Alignment:
| Q |
232 |
aacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32379968 |
aacttttgaacaactttctctctcatact |
32379940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 14)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 27352644 - 27352690
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
27352644 |
gtacaaccattttgtgataacttttggacaactttctctctcatact |
27352690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 214 - 261
Target Start/End: Original strand, 26501309 - 26501356
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatactt |
261 |
Q |
| |
|
||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
26501309 |
gtacaaccattttgtaataacttttggacaactttctctctcatactt |
26501356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 218 - 260
Target Start/End: Original strand, 5959406 - 5959448
Alignment:
| Q |
218 |
aaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
5959406 |
aaccattatgtgacaacttttggacaactttctctctcatact |
5959448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 11097941 - 11097895
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||| ||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11097941 |
gtacatccattttgtgacaacttttgaacaactttctctctcatact |
11097895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 29489416 - 29489370
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||||||||||||||| |
|
|
| T |
29489416 |
gtacaaccattttgtgataactttggtacaactttctctctcatact |
29489370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 43457876 - 43457832
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcata |
258 |
Q |
| |
|
||||||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
43457876 |
gtacaaccattttgcgataacttttggacaactttctctctcata |
43457832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 3919314 - 3919360
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
3919314 |
gtacaaccattttgttataatttttggacaactttctctctcatact |
3919360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 260
Target Start/End: Complemental strand, 7078545 - 7078511
Alignment:
| Q |
226 |
tgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7078545 |
tgtgacaacttttgaacaactttctctctcatact |
7078511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 217 - 259
Target Start/End: Complemental strand, 35972858 - 35972816
Alignment:
| Q |
217 |
caaccattatgtgataacttttgaacaactttctctctcatac |
259 |
Q |
| |
|
|||||||| ||||| |||||||| ||||||||||||||||||| |
|
|
| T |
35972858 |
caaccattttgtgacaacttttgtacaactttctctctcatac |
35972816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 42256474 - 42256520
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| |||||| | |||||||||||||||||||| |
|
|
| T |
42256474 |
gtacaaccattttgtgacaactttggtacaactttctctctcatact |
42256520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 260
Target Start/End: Original strand, 19651425 - 19651470
Alignment:
| Q |
215 |
tacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
|||||||||| ||||| |||||||| | |||||||||||||||||| |
|
|
| T |
19651425 |
tacaaccattttgtgacaacttttgtataactttctctctcatact |
19651470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 260
Target Start/End: Complemental strand, 30530630 - 30530585
Alignment:
| Q |
215 |
tacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
|||||||||| ||||| ||||||| |||||||||||||||||||| |
|
|
| T |
30530630 |
tacaaccattttgtgacaacttttagacaactttctctctcatact |
30530585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 26585230 - 26585186
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcata |
258 |
Q |
| |
|
||||||| ||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
26585230 |
gtacaactattttgtgataacttttgtacaactttttctctcata |
26585186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 232 - 260
Target Start/End: Complemental strand, 34395958 - 34395930
Alignment:
| Q |
232 |
aacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34395958 |
aacttttgaacaactttctctctcatact |
34395930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 214 - 255
Target Start/End: Complemental strand, 5954540 - 5954499
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctc |
255 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5954540 |
gtacaaccattatgtgataacttttggacaactttctctctc |
5954499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 9695118 - 9695072
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
|||||||||||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
9695118 |
gtacaaccattatgagataatttttggacaactttctctctcatact |
9695072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 214 - 261
Target Start/End: Complemental strand, 43622005 - 43621958
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatactt |
261 |
Q |
| |
|
||||||| ||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
43622005 |
gtacaactattttatgacaacttttgaacaactttctctctcatactt |
43621958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 29168739 - 29168785
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| | ||| |||||||| |||||||||||||||||||| |
|
|
| T |
29168739 |
gtacaaccattttttgacaacttttgcacaactttctctctcatact |
29168785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 36909900 - 36909854
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||||||||||| |||||| |
|
|
| T |
36909900 |
gtacaaccattttgtgacaacttttggacaactttctctcacatact |
36909854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 221 - 258
Target Start/End: Complemental strand, 14954649 - 14954612
Alignment:
| Q |
221 |
cattatgtgataacttttgaacaactttctctctcata |
258 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
14954649 |
cattttgtgacaacttttgaacaactttctctctcata |
14954612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 13)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 214 - 257
Target Start/End: Original strand, 12141913 - 12141956
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcat |
257 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
12141913 |
gtacaaccattttgtgataacttttgaacaactttttctctcat |
12141956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 29763844 - 29763890
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||| ||||||||| |
|
|
| T |
29763844 |
gtacaaccattttgtgataacttttgtacaactttctttctcatact |
29763890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 33050197 - 33050243
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
33050197 |
gtacaaccattttgtgacaacttttgtacaactttctctctcatact |
33050243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 44175559 - 44175605
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
|||||| |||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
44175559 |
gtacaatcattttgtgataacttttgtacaactttctctctcatact |
44175605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 216 - 260
Target Start/End: Original strand, 13437214 - 13437258
Alignment:
| Q |
216 |
acaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
13437214 |
acaaccattttgtgacaacttttgaacaactttttctctcatact |
13437258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 213 - 260
Target Start/End: Original strand, 44511152 - 44511199
Alignment:
| Q |
213 |
cgtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
|||||||||||| ||||| |||||||| |||||||||||| ||||||| |
|
|
| T |
44511152 |
cgtacaaccattttgtgacaacttttgtacaactttctctttcatact |
44511199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 2347116 - 2347070
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| |||||| | |||||||||||||||||||| |
|
|
| T |
2347116 |
gtacaaccattttgtgacaactttggtacaactttctctctcatact |
2347070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 4971304 - 4971350
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||||||||||||||||| |
|
|
| T |
4971304 |
gtacaaccattttgtgacaacttttatacaactttctctctcatact |
4971350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 19426594 - 19426640
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||||||||||||||||| |
|
|
| T |
19426594 |
gtacaaccattttgtgacaactttttgacaactttctctctcatact |
19426640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 30864474 - 30864428
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||| | ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
30864474 |
gtacaaccaatttgtgacaacttttgtacaactttctctctcatact |
30864428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 43079689 - 43079643
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||| | |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
43079689 |
gtacaaccactttgtgataatttttggacaactttctctctcatact |
43079643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 232 - 260
Target Start/End: Complemental strand, 18926036 - 18926008
Alignment:
| Q |
232 |
aacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18926036 |
aacttttgaacaactttctctctcatact |
18926008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 258
Target Start/End: Original strand, 38978506 - 38978550
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcata |
258 |
Q |
| |
|
||||||||||| | |||||||||||| |||||||||||| ||||| |
|
|
| T |
38978506 |
gtacaaccattctatgataacttttgtacaactttctctttcata |
38978550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0332 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0332
Description:
Target: scaffold0332; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 541 - 587
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||||||||| |||||| | |||||||||||||||||||| |
|
|
| T |
541 |
gtacaaccattatgtgacaactttgggacaactttctctctcatact |
587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 18609 - 18655
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||||||||||||||| |
|
|
| T |
18609 |
gtacaaccaatttgtgataacttttgtacaactttctctctcatact |
18655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 3339556 - 3339510
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
3339556 |
gtacaaccattttgtgacaacttttgtacaactttctctctcatact |
3339510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 17417292 - 17417246
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
|||||| |||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
17417292 |
gtacaatcattatgtgacaatttttggacaactttctctctcatact |
17417246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 13)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 8680955 - 8681001
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
8680955 |
gtacaaccattatgtgatattttttggacaactttctctctcatact |
8681001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 34259829 - 34259875
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| |||| |||||||||||||||||||||||| |
|
|
| T |
34259829 |
gtacaaccattttgtgacaactgttgaacaactttctctctcatact |
34259875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 36444452 - 36444406
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
36444452 |
gtacaaccattttatgataactttttaacaactttctctctcatact |
36444406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 5208384 - 5208338
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||| | ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
5208384 |
gtacaaccaatttgtgacaacttttgtacaactttctctctcatact |
5208338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 8455875 - 8455921
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||| ||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
8455875 |
gtacaactattttgtgacaacttttgaacaactttctctctaatact |
8455921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 256
Target Start/End: Complemental strand, 33484165 - 33484123
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctca |
256 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
33484165 |
gtacaaccattttgtgataatttttggacaactttctctctca |
33484123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 215 - 261
Target Start/End: Original strand, 40258220 - 40258266
Alignment:
| Q |
215 |
tacaaccattatgtgataacttttgaacaactttctctctcatactt |
261 |
Q |
| |
|
|||||||||| | |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
40258220 |
tacaaccattttatgataatttttgaataactttctctctcatactt |
40258266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 47519777 - 47519731
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||| ||||| ||| | ||||||||||||||||||||||||||||| |
|
|
| T |
47519777 |
gtacatccattttgtaacaacttttgaacaactttctctctcatact |
47519731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 260
Target Start/End: Complemental strand, 20632704 - 20632659
Alignment:
| Q |
215 |
tacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
|||||||||| | |||||||||||| | |||||||||||||||||| |
|
|
| T |
20632704 |
tacaaccattttttgataacttttgcataactttctctctcatact |
20632659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 226 - 259
Target Start/End: Original strand, 47105937 - 47105970
Alignment:
| Q |
226 |
tgtgataacttttgaacaactttctctctcatac |
259 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
47105937 |
tgtgataacttttgtacaactttctctctcatac |
47105970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 258
Target Start/End: Original strand, 3475883 - 3475927
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcata |
258 |
Q |
| |
|
||||||||||| | ||| |||||||| |||||||||||||||||| |
|
|
| T |
3475883 |
gtacaaccattttatgacaacttttgtacaactttctctctcata |
3475927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 258
Target Start/End: Original strand, 20056410 - 20056454
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcata |
258 |
Q |
| |
|
||||||| ||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
20056410 |
gtacaactattatgttataatttttggacaactttctctctcata |
20056454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 258
Target Start/End: Complemental strand, 52669654 - 52669622
Alignment:
| Q |
226 |
tgtgataacttttgaacaactttctctctcata |
258 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
52669654 |
tgtgataacttttgtacaactttctctctcata |
52669622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 13)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 11327122 - 11327168
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
11327122 |
gtacaaccattttgtgacaacttttgtacaactttctctctcatact |
11327168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 27162526 - 27162480
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||| | ||||||||||||||||||||||||||||| |
|
|
| T |
27162526 |
gtacaaccattttgtaacaacttttgaacaactttctctctcatact |
27162480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 2482731 - 2482687
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcata |
258 |
Q |
| |
|
||||| ||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
2482731 |
gtacatccattttgtgacaacttttgaacaactttctctctcata |
2482687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 258
Target Start/End: Complemental strand, 16139352 - 16139308
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcata |
258 |
Q |
| |
|
||||||||||| | ||||||||||||||||| ||||||||||||| |
|
|
| T |
16139352 |
gtacaaccattttatgataacttttgaacaattttctctctcata |
16139308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 218 - 261
Target Start/End: Original strand, 27936982 - 27937025
Alignment:
| Q |
218 |
aaccattatgtgataacttttgaacaactttctctctcatactt |
261 |
Q |
| |
|
||||||| ||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
27936982 |
aaccattttgtgacaacttttgaataactttctctctcatactt |
27937025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 48405424 - 48405471
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttg-aacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
48405424 |
gtacaaccattttgtgacaacttttgtaacaactttctctctcatact |
48405471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 462458 - 462412
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||||||||||||||||| |
|
|
| T |
462458 |
gtacaaccattttgtgacaacttttagacaactttctctctcatact |
462412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 1295346 - 1295392
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||| ||| |||||||||||||| |||||||| ||||||||||| |
|
|
| T |
1295346 |
gtacaactattttgtgataacttttggacaactttttctctcatact |
1295392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 8254041 - 8254087
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| ||||| |||||| | |||||||||||||||||||| |
|
|
| T |
8254041 |
gtacaaccattttgtgacaactttggtacaactttctctctcatact |
8254087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Complemental strand, 32931975 - 32931929
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||| | ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
32931975 |
gtacaaccaatttgtgacaacttttgtacaactttctctctcatact |
32931929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 36818970 - 36819016
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||| | ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
36818970 |
gtacaaccaatttgtgacaacttttgtacaactttctctctcatact |
36819016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 63
Target Start/End: Complemental strand, 45590800 - 45590770
Alignment:
| Q |
33 |
tttgaattgacttttttgaacttatctacta |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45590800 |
tttgaattgacttttttgaacttatctacta |
45590770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 216 - 260
Target Start/End: Complemental strand, 25959597 - 25959553
Alignment:
| Q |
216 |
acaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||| | ||||||||||||| |||||||||||||||||||| |
|
|
| T |
25959597 |
acaaccactttgtgataacttttagacaactttctctctcatact |
25959553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0522 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0522
Description:
Target: scaffold0522; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 222 - 260
Target Start/End: Complemental strand, 2553 - 2515
Alignment:
| Q |
222 |
attatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
2553 |
attatgtgataatttttggacaactttctctctcatact |
2515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 226 - 260
Target Start/End: Complemental strand, 249187 - 249153
Alignment:
| Q |
226 |
tgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |
|
|
| T |
249187 |
tgtgataacttttgtacaactttctctctcatact |
249153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 260
Target Start/End: Original strand, 337132 - 337178
Alignment:
| Q |
214 |
gtacaaccattatgtgataacttttgaacaactttctctctcatact |
260 |
Q |
| |
|
||||||||||| | ||| |||||||||| |||||||||||||||||| |
|
|
| T |
337132 |
gtacaaccattttctgacaacttttgaataactttctctctcatact |
337178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University