View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17473_high_34 (Length: 272)
Name: NF17473_high_34
Description: NF17473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17473_high_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 16274461 - 16274703
Alignment:
| Q |
1 |
ctaagttgacgattttcatatactttaaggactgcttagtatattgatatagtttagagactaaataggtggtttattccttattttgtttgtgttgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
16274461 |
ctaagttgacgattttcatatactttaagg-ctgcttagtatattgatatagtttagagactaaattggtggtttattccttattttgttt--------- |
16274550 |
T |
|
| Q |
101 |
cggtttgtgattttcgagaatagaagcagaagcggactgaggaagagtggagtagaaagatacaggaattgcagggtgaattggcttttgttaaagaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16274551 |
------gtgattttcgagaatagaagcagaagcggactgaggaagagtggagtagaaagatacaggaattgcagggtgaattggcttttgttaaagaaga |
16274644 |
T |
|
| Q |
201 |
gagacagaaattggagagaaaggtttggggactttaattttatgtgctgttgtagtgtg |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
16274645 |
gagacagaaattggagagaaaggtttggggaatttaattttatgtgctgttgaagtgtg |
16274703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University