View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17473_high_54 (Length: 208)

Name: NF17473_high_54
Description: NF17473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17473_high_54
NF17473_high_54
[»] chr6 (1 HSPs)
chr6 (20-194)||(16456869-16457043)


Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 194
Target Start/End: Complemental strand, 16457043 - 16456869
Alignment:
20 tttgggtttgggaagccagagattgtgagaagtgggaccaataacaaatttgatggaatgatttacttgtatccagggaagagtggaggaaggagcattg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||    
16457043 tttgggtttgggaagccagagattgtgagaagtgggaccaataacaaatttgatggaatgatttatttgtatccagggaagagtggagggaggagcattg 16456944  T
120 atgttgaattaacattggagcctgaggctatgggaaggttggagcaagataaggaatttcttatggaagtataat 194  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16456943 atgttgaattaacattagagcctgaggctatgggaaggttggagcaagataaggaatttcttatggaagtataat 16456869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University