View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17473_low_25 (Length: 367)
Name: NF17473_low_25
Description: NF17473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17473_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 77 - 343
Target Start/End: Original strand, 32982277 - 32982543
Alignment:
| Q |
77 |
gcataggagatatgggatgggattaccctcttattaattcctatatgtattaattataactgaatcttatcacagccatctccaagttgccctgataaat |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32982277 |
gcataggagatatgggatgggattaccctcttattaattcctatatgtattaattataactgaatcttatcacagccatctccaagttgccctgataaat |
32982376 |
T |
 |
| Q |
177 |
cttcactacttctatactccgcagtgtccacaacattcatatcagcctcagctgtggttgtctctgtcaccaattgtacagttttctttgttgcatccca |
276 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32982377 |
cttcactacttctatactccacagtgtccacaacattcatatcagcctcagctgtggttgtctcagtcaccaattgtacagttttctttgttgcatccca |
32982476 |
T |
 |
| Q |
277 |
tgcagtttccacattttccttaccaacttcttcaagtacctctcttgcattctctgacccttcattt |
343 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32982477 |
tgcagtttccacattttccttaccaacttcttcaagtacctctcttgcattctctgacccttgattt |
32982543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 192 - 311
Target Start/End: Original strand, 27037952 - 27038071
Alignment:
| Q |
192 |
actccgcagtgtccacaacattcatatcagcctcagctgtggttgtctctgtcaccaattgtacagttttctttgttgcatcccatgcagtttccacatt |
291 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
27037952 |
actccgcagtgtccacggcattcatatcagcctcagcagtggttgtctctgtcaccaattgtacagtgttctttgtagcatcccatgcagtttccacatt |
27038051 |
T |
 |
| Q |
292 |
ttccttaccaacttcttcaa |
311 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27038052 |
ttccttaccaacttcttcaa |
27038071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University