View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17473_low_27 (Length: 346)
Name: NF17473_low_27
Description: NF17473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17473_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 1 - 341
Target Start/End: Original strand, 52780126 - 52780466
Alignment:
| Q |
1 |
actaaagggaagagatcattcttaacaacggtggcgaatccaacgagtcatttatcggttataggaaatttgattggagcacaagctgcagcagaaatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52780126 |
actaaagggaagagatcattcttaacaacggtggcgaatccaacgagtcatttatcggttataggaaatttgattggagcacaagctgcagcagaaatgg |
52780225 |
T |
|
| Q |
101 |
gttggaaagaaagtgctgtttgtttgttttcattagggatggtgcattatttggtgttgtttgtgacactttatcaaaggttgtctggtggtgatcgtct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52780226 |
gttggaaagaaagtgctgtttgtttgttttcattagggatggtgcattatttggtgttgtttgtgacactttatcaaaggttgtctggtggtgatcgtct |
52780325 |
T |
|
| Q |
201 |
tcctgcgttgttaaggccagttttcttcttgttctttgcagcacctggtgtggctagtttggcttgggaatctattgttggagattttgatactctttcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52780326 |
tcctgcgttgttaaggccagttttcttcttgttctttgcagcacctggtgtggctagtttggcttgggaatctattgttggagattttgatactctttcc |
52780425 |
T |
|
| Q |
301 |
aagatgctattctttttgtccctattcctcttcatctcact |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
52780426 |
aagatgctattctttttgtccctattcctcttcatgtcact |
52780466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 329
Target Start/End: Original strand, 17470861 - 17470967
Alignment:
| Q |
223 |
ttcttcttgttctttgcagcacctggtgtggctagtttggcttgggaatctattgttggagattttgatactctttccaagatgctattctttttgtccc |
322 |
Q |
| |
|
||||||||||||||||| || ||| || ||||||||||||||||| ||||| || ||| | ||||||||| ||| |||||||| |||||| | |||| |
|
|
| T |
17470861 |
ttcttcttgttctttgctgctcctagtatggctagtttggcttggcaatctgtttgtggttactttgatactgcttctaagatgctgttctttctctccc |
17470960 |
T |
|
| Q |
323 |
tattcct |
329 |
Q |
| |
|
| ||||| |
|
|
| T |
17470961 |
tcttcct |
17470967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University