View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17473_low_28 (Length: 329)
Name: NF17473_low_28
Description: NF17473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17473_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 17 - 138
Target Start/End: Original strand, 44007655 - 44007776
Alignment:
| Q |
17 |
agttcggaggctgctggtaatgttttcttgactgttcatggtcgtgatcttggtgtttacgcggctatgtgaaatgtaggtcacctttcagtacccatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44007655 |
agttcggaggctgctggtaatgttttcttgactgttcatggtcgtgatcttggtgtttacgcggctatgtgaaatgtaggtcacctttcagtacccatgt |
44007754 |
T |
|
| Q |
117 |
ttgtgtttcattttgaagatac |
138 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
44007755 |
ttgtgtttcattttgaagatac |
44007776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 203 - 316
Target Start/End: Original strand, 44007841 - 44007954
Alignment:
| Q |
203 |
ggtatgtttggattgatgtatttaatctaattagtacttgtgagactgtttgaaggagttttttaaaatgacttatgacatgtttgtaagctcgtcatga |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44007841 |
ggtatgtttggattgatgtatttaatctaattagtacttgtgagactgtttgaaggagtttattaaaatgacttatgacatgtttgtaagctcgtcatga |
44007940 |
T |
|
| Q |
303 |
tagcttatatgaaa |
316 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44007941 |
tagcttatatgaaa |
44007954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University