View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17473_low_37 (Length: 269)
Name: NF17473_low_37
Description: NF17473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17473_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 53193212 - 53192955
Alignment:
| Q |
1 |
tagtatcctaattaaaatctccattttattgtgcccactgtcttcttataa-ttgcttacttaacatatcattcatgatcacctaagcctattcctttct |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53193212 |
tagtatcctaattaaaatctccattttattgtgcccactgtcttcttataaattacttacttaacatatcattcatgatcacctaagcctattcctttct |
53193113 |
T |
|
| Q |
100 |
tcctttcatcttaacaattctgcctccttcaaagatcagacatttatttgattaaaatgtctgctggaacatttgcagctccagttgctgggcctggatt |
199 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
53193112 |
tcctttcatcttaactattctgcctccttcaaagatcagacatttatttgattaaaatgtctgctggaacatttgcagctccagttgctgggcctggctt |
53193013 |
T |
|
| Q |
200 |
tgtgggcttgaagtccaactcatcaaatctttggccctgtgctacttattccagtgaa |
257 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||| |
|
|
| T |
53193012 |
tgtgggcttgaagtccaactcatcaagtctttggcccagtgctacttattccattgaa |
53192955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University