View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17473_low_38 (Length: 265)
Name: NF17473_low_38
Description: NF17473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17473_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 4945191 - 4944937
Alignment:
| Q |
1 |
ccctccttattagtgagacttgtgtgggaaatttgcgatgcatggagtctattatcatatggttcagatattttaagggcttgaaggcgggaaattctca |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4945191 |
ccctccttattggtgagacttgtgtgggaaatttgcgatgcatggagtctattatcatatggttcagatattttaagggcttgaaggcgggaaattctca |
4945092 |
T |
 |
| Q |
101 |
aatggctcttgaagatgccattttctcttggttattttttgggctttaaggtgggaaattcggatattataatgtctcatttacaatatgccgatgaaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
4945091 |
aatggctcttgaagatgccattttctcttggttattttttgggctttaaggtggcgaattcggatattatagtgtcccatttacaatatgccgatgaaag |
4944992 |
T |
 |
| Q |
201 |
cctccttattgatgagacttgtgtggaaaatttatggtgcatgaagtatattctt |
255 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4944991 |
cctccttattggtgagacttgtgtggaaaatttatggtgcatgaagtatattctt |
4944937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 122 - 233
Target Start/End: Complemental strand, 4945269 - 4945158
Alignment:
| Q |
122 |
tttctcttggttattttttgggctttaaggtgggaaattcggatattataatgtctcatttacaatatgccgatgaaagcctccttattgatgagacttg |
221 |
Q |
| |
|
||||||| || |||||| |||||||||||| ||||||||||||||| || | ||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
4945269 |
tttctctaggatattttaggggctttaaggtaggaaattcggatattgtagtctctcatttacaatatgccgatgaaaccctccttattggtgagacttg |
4945170 |
T |
 |
| Q |
222 |
tgtggaaaattt |
233 |
Q |
| |
|
||||| |||||| |
|
|
| T |
4945169 |
tgtgggaaattt |
4945158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University