View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17473_low_42 (Length: 237)
Name: NF17473_low_42
Description: NF17473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17473_low_42 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 21 - 219
Target Start/End: Original strand, 1176088 - 1176286
Alignment:
| Q |
21 |
ttctccgcgcctccaaccctctgtcatcttctcacccttctccgaccttaacaccaccagaatcgccacctcttctcttcaaagttgcaaccgcactgcc |
120 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1176088 |
ttcttcgcgcctccaaccctctgtcatcttctcacctttctccgaccctaacaccaccagaatcgccacctcttctcttcaaagttgcaaccgcaccgcc |
1176187 |
T |
|
| Q |
121 |
acctctttttcctcataaccaccgccgcctgttttcaagctgttcagatctagaaatgtcacatcgccggcgatcttcttttctcccacactgtatcat |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
1176188 |
gcctcttcttcctcataaccaccgccgcctgttttcaagctgttcagatccagaaatgtcacatcgccggtgatcttcttttctcccgcactgtatcat |
1176286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 31 - 219
Target Start/End: Complemental strand, 55038962 - 55038774
Alignment:
| Q |
31 |
ctccaaccctctgtcatcttctcacccttctccgaccttaacaccaccagaatcgccacctcttctcttcaaagttgcaaccgcactgccacctcttttt |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||| || |
|
|
| T |
55038962 |
ctccaaccctctgtcatcttctcacccttctccgaccctaacaccaccagaatcgccacctcttctcttcaaagttgcaaccacaccgccgcctcttctt |
55038863 |
T |
|
| Q |
131 |
cctcataaccaccgccgcctgttttcaagctgttcagatctagaaatgtcacatcgccggcgatcttcttttctcccacactgtatcat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55038862 |
cctcataaccaccgccgcctgttttcaagctgttcagatccagaaatgtcacatcgccggcgatcttcttttctcccgcactgtatcat |
55038774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 21 - 218
Target Start/End: Original strand, 5197063 - 5197260
Alignment:
| Q |
21 |
ttctccgcgcctccaaccctctgtcatcttctcacccttctccgaccttaacaccaccagaatcgccacctcttctcttcaaagttgcaaccgcactgcc |
120 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||| ||| |
|
|
| T |
5197063 |
ttcttcgcgcctccaaccctctgtcatcttctcacctttctccgaccctaacaccactagaatcgccacctcttctcttcaaagttgcaaccacaccgcc |
5197162 |
T |
|
| Q |
121 |
acctctttttcctcataaccaccgccgcctgttttcaagctgttcagatctagaaatgtcacatcgccggcgatcttcttttctcccacactgtatca |
218 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
5197163 |
gcctcttcttcctcataaccaccgccgcctgttttcaagctgttcagatccagaaatgtcacatcgccggtgatcttcttttctcccgcactgtatca |
5197260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 21 - 219
Target Start/End: Original strand, 8004264 - 8004461
Alignment:
| Q |
21 |
ttctccgcgcctccaaccctctgtcatcttctcacccttctccgaccttaacaccaccagaatcgccacctcttctcttcaaagttgcaaccgcactgcc |
120 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||| ||||||||| ||| ||| |
|
|
| T |
8004264 |
ttctccgcgcttccaaccctctgtcatcttctcacccttctccaaccctaacaccaccagaatcgccacctcttctcttcaa-gttgcaaccacaccgcc |
8004362 |
T |
|
| Q |
121 |
acctctttttcctcataaccaccgccgcctgttttcaagctgttcagatctagaaatgtcacatcgccggcgatcttcttttctcccacactgtatcat |
219 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
8004363 |
gcctcttcttcctcataaccactgccgcctgttttcaagctgttcagatccggaaatgtcacatcgccggcgatcttcttttctcctgcattgtatcat |
8004461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University