View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17473_low_45 (Length: 235)
Name: NF17473_low_45
Description: NF17473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17473_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 4063109 - 4062890
Alignment:
| Q |
1 |
aatgtataaatttttatccaaatggtgtttatctgatggttcatattccgaacataagtttaatgtcagttaaagatctaaaaatgtgcctttaacttgt |
100 |
Q |
| |
|
||||||||||||| ||| |||||||||||||| || |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
4063109 |
aatgtataaatttctatataaatggtgtttatccgacagttcatattccgaacataagtttaatgtcagttaaagacctacaaatgtgcctttaacttgt |
4063010 |
T |
 |
| Q |
101 |
ccaactcttaccaagcataagttaaatcgaggtccaattatgcaaaggcacaatacgctatatacattttcagtttgctacaaacaaggcttcaacaaca |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4063009 |
ccaactcttaccaagcataagctaaatcgaggtccaattatgcaaaggcacaatacgctatatacattttcagtttgctacaaacaaggcttcaacaaca |
4062910 |
T |
 |
| Q |
201 |
ggaagcataaacgcttcttg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4062909 |
ggaagcataaacgcttcttg |
4062890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University