View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17473_low_56 (Length: 209)
Name: NF17473_low_56
Description: NF17473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17473_low_56 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 16456676 - 16456889
Alignment:
| Q |
1 |
gttcaaattcaatcaaagcatacatcc-----accaaatacaaaaacctatcaagcaacacacaacattatatcaaatcaaatatacctaaacataatat |
95 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16456676 |
gttcaaattcaatcaaagcatacaaccaccaaaccaaatacaaaaacctatcaagcaacacacaacattatatcaaatcaaatatacctaaacataatat |
16456775 |
T |
 |
| Q |
96 |
ttttgaagaataatcccttcaacaatctaaaaagtagaacttccaaattccatcaatacccaacttttattgcacaaattcttgctagtttaaattatac |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16456776 |
ttttgaagaataatcccttcaacaatctaaaaagtagaacttccaaattccatcaatacccaacttttattgcacaaattcttgctagtttaaattatac |
16456875 |
T |
 |
| Q |
196 |
ttccataagaaatt |
209 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
16456876 |
ttccataagaaatt |
16456889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University