View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17473_low_58 (Length: 208)
Name: NF17473_low_58
Description: NF17473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17473_low_58 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 194
Target Start/End: Complemental strand, 16457043 - 16456869
Alignment:
| Q |
20 |
tttgggtttgggaagccagagattgtgagaagtgggaccaataacaaatttgatggaatgatttacttgtatccagggaagagtggaggaaggagcattg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
16457043 |
tttgggtttgggaagccagagattgtgagaagtgggaccaataacaaatttgatggaatgatttatttgtatccagggaagagtggagggaggagcattg |
16456944 |
T |
|
| Q |
120 |
atgttgaattaacattggagcctgaggctatgggaaggttggagcaagataaggaatttcttatggaagtataat |
194 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16456943 |
atgttgaattaacattagagcctgaggctatgggaaggttggagcaagataaggaatttcttatggaagtataat |
16456869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University