View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17474_high_31 (Length: 291)
Name: NF17474_high_31
Description: NF17474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17474_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 4 - 277
Target Start/End: Original strand, 7166666 - 7166944
Alignment:
| Q |
4 |
gagtgagaagaattgtcttcagtcatgt---ttccattgctaaaaagtgcgacctga--gccgtcaagattccaaacccttgtttttggatgaaaaatcg |
98 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7166666 |
gagtgataagaattgtcttcagtcatgtaatttccattgctaaaaagtgccacctgatcgccgtcaagattccaaacccttgtttttggatgaaaaaaca |
7166765 |
T |
|
| Q |
99 |
cattattatgcatgcatgtttacgcaacacgcatgagtgttgtgttttagactgtaaaacatgcggcaactttgattcgggtgtgtgccttcatccttca |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7166766 |
cattattatgcatgcatgtttacgcaacgcgcataagtgttgtgttttagactgtaaaacatgcggcaactttgattcgggtgtgtgccttcgtccttca |
7166865 |
T |
|
| Q |
199 |
agacgcacgcatggctcaggaacacttttccctgatttcttctctcttcatggaattttcatctttgatatgttctttg |
277 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166866 |
agacgcacacatggctcaggaacacttttccccgatttcttctctcttcatggaattttcatctttgatatgttctttg |
7166944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University