View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17474_low_21 (Length: 340)
Name: NF17474_low_21
Description: NF17474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17474_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 173 - 295
Target Start/End: Original strand, 39065855 - 39065977
Alignment:
| Q |
173 |
taattagttcattttggtaccccaaagtccagttagttagtaagaagatgaacaaaaccctaaccatttttataatgattgcatttgtgcatgcgcgtag |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39065855 |
taattagttcattttggtaccccaaagtccagttagttagtaagaagatgaacaaaaccctaaccatttttataatgattgcatttgtgcatgcgcgtag |
39065954 |
T |
|
| Q |
273 |
aacaacataacagggagtagtac |
295 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39065955 |
aacaacataacagggagtagtac |
39065977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 18 - 125
Target Start/End: Original strand, 39065686 - 39065797
Alignment:
| Q |
18 |
aaattagaacttgtgtaatcaacaattaaaaagg----aaaaaaatgttgtttttaatgnnnnnnnnngttttctcaaccaatgtttcaagaacactagt |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
39065686 |
aaattagaacttatgtaatcaacaattaaaaaggaaaaaaaaaaatgttgtttttaatgtttttttttgttttctcaaccaatgttccaagaacactagt |
39065785 |
T |
|
| Q |
114 |
tgacatgaccca |
125 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
39065786 |
tgacttgaccca |
39065797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University