View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17474_low_35 (Length: 274)
Name: NF17474_low_35
Description: NF17474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17474_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 42 - 270
Target Start/End: Original strand, 31078879 - 31079103
Alignment:
| Q |
42 |
caactagcctaatagtgatatattcatcgcatacggtgaataagtaggggaatttgtgatttgggatcccagcttctgcatactttaacgtctctgtgaa |
141 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31078879 |
caactagcctaatagtaatatattcatcgtatacggtgaataagtaggggaatttgagatttgg-atcccagcttctgcatactttaacgtctctgtgaa |
31078977 |
T |
|
| Q |
142 |
ctgagatagactcatgaagacattaattattgtagggaataagtgaggaataaataataataatatggagtttgaaatcttactgatgcatatgtaatgt |
241 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
31078978 |
ctgagatagactcatgaagacgttaattattgtagaaaataagtgaggaata---aataataatatggagtttgaaatctgacttatgcatatgtaatgt |
31079074 |
T |
|
| Q |
242 |
ctttttaaactacattatactcacgagga |
270 |
Q |
| |
|
|||||||||||| |||||||||||||||| |
|
|
| T |
31079075 |
ctttttaaactaaattatactcacgagga |
31079103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University