View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17474_low_37 (Length: 259)
Name: NF17474_low_37
Description: NF17474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17474_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 44613201 - 44613443
Alignment:
| Q |
1 |
taggttcagctgatctttttacattggctggtatgatggagtttttcttcactgaggcaccttggagtatgaggtctttagctacatcactttcatgggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44613201 |
taggttcagctgatctttttacattggctggtatgatggagtttttcttcactgaggcaccttggagtatgaggtctttagctacatcactttcatgggc |
44613300 |
T |
|
| Q |
101 |
ttcattggctatgggatattttcttagcactgttcttgtgtctgttatcaataaggtgactggagcatttggagaaacaccatggctgttgggtgaaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44613301 |
ttcattggctatgggatattttcttagcactgttcttgtgtctgttatcaataaggtgactggagcatttggagaaacaccatggctgttgggtgaaaac |
44613400 |
T |
|
| Q |
201 |
ttgaatgattatcatcttgagaggttttattggttgatgtgtg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44613401 |
ttgaatgattatcatcttgagaggttttattggttgatgtgtg |
44613443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 3 - 120
Target Start/End: Original strand, 16830214 - 16830331
Alignment:
| Q |
3 |
ggttcagctgatctttttacattggctggtatgatggagtttttcttcactgaggcaccttggagtatgaggtctttagctacatcactttcatgggctt |
102 |
Q |
| |
|
||||||||||||||||| ||||||||||| | |||| ||||||||| | || ||||||| |||||||| || ||||| ||||||||||| ||||||| |
|
|
| T |
16830214 |
ggttcagctgatcttttcacattggctggattactggaatttttcttctcagaagcaccttcaagtatgagatcattagcaacatcactttcttgggctt |
16830313 |
T |
|
| Q |
103 |
cattggctatgggatatt |
120 |
Q |
| |
|
| ||||| |||||||||| |
|
|
| T |
16830314 |
ctttggcaatgggatatt |
16830331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University