View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17474_low_44 (Length: 240)
Name: NF17474_low_44
Description: NF17474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17474_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 32934850 - 32935080
Alignment:
| Q |
1 |
ttcagtgccattttcattgaactctactacatatgtgctagtgtgtggggtcatcagatttataccatatacagcattttgttcattgttttcatcattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32934850 |
ttcagtgccattttcattgaactctactacatatttgctagtgtgtggggtcatcagatttataccatatacagcattttgttcattgttttcatcattc |
32934949 |
T |
|
| Q |
101 |
ttttgattgtcactgcttttggtaatgtggcattgacatactttcaacttgctgctgaggatcatgaatggtggtggaggtatgtattatgtaacaccga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32934950 |
ttttgattgtcactgcttttggtaatgtggcattgacatactttcaacttgctgctgaggatcatgaatggtggtggaggtatgtattatgtaacaccga |
32935049 |
T |
|
| Q |
201 |
gtgccctctctactttctttgtttattcatc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32935050 |
gtgccctctctactttctttgtttattcatc |
32935080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 27759874 - 27760057
Alignment:
| Q |
1 |
ttcagtgccattttcattgaactctactacatatgtgctagtgtgtggggtcatcaga-tttataccatatacagcattttgttcattgttttcatcatt |
99 |
Q |
| |
|
|||||||| |||| ||| ||||| || || |||| ||| ||||| ||||| || |||| |||| || || ||||||||| |||| ||||| ||||||||| |
|
|
| T |
27759874 |
ttcagtgctatttacatcgaactttattatatatttgccagtgtctggggcca-cagaatttacacaatctacagcattctgtttattgtcttcatcatt |
27759972 |
T |
|
| Q |
100 |
cttttgattgtcactgcttttggtaatgtggcattgacatactttcaacttgctgctgaggatcatgaatggtggtggaggtatg |
184 |
Q |
| |
|
|| |||||||| |||||||| || |||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27759973 |
ctcttgattgttactgctttcattactgtggcattgacatacttccagcttgctgctgaagatcatgaatggtggtggaggtatg |
27760057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University