View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17474_low_45 (Length: 238)
Name: NF17474_low_45
Description: NF17474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17474_low_45 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 7 - 205
Target Start/End: Original strand, 51293692 - 51293890
Alignment:
| Q |
7 |
tgagatgaaaagtgagaaagacatacattcaacaaagttaggagcagaagcattaacctaattccgtaggcactattatatttatttatttatataaaga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
51293692 |
tgagatgaaaagtgagaaagacatacattcaacaaagttaggagcagaagcattaatctaattccgtaggcactattatat---tttatttatataaaga |
51293788 |
T |
 |
| Q |
107 |
aggcatcttttgtgtgggggaaacaaaagcaaagctgggtgg---gtagtagtgttgcaaggaaaaagggaagaaccgcagcaggtttagtcaaaataca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51293789 |
aggcatcttttgtgtgggggaaacaaaagcaaagctgggtgggtagtagtagtgttgcaaggaaaaagggaagaaccgcagcaggttaagtcaaaataca |
51293888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University