View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17474_low_46 (Length: 238)
Name: NF17474_low_46
Description: NF17474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17474_low_46 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 54248395 - 54248521
Alignment:
| Q |
1 |
tgccaccgtgattttgccaaactaaccaataatccaaatatttagttagtgctgtttgagtcttcactcgtcaggctaacgtgacccacttttacccaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54248395 |
tgccaccgtgattttgccaaactaacctataatccaaatatttagttagtgctgtttgagtcgtcactcgtcaggctaacgtgacccacttttacccaat |
54248494 |
T |
|
| Q |
101 |
tcacttggtgcatgttgggattcactc |
127 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
54248495 |
tcacctggtgcatgttgggattcactc |
54248521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 190 - 219
Target Start/End: Original strand, 54248584 - 54248613
Alignment:
| Q |
190 |
gatgcttataattcgtcttgatgaattttc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54248584 |
gatgcttataattcgtcttgatgaattttc |
54248613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University