View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17474_low_56 (Length: 208)
Name: NF17474_low_56
Description: NF17474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17474_low_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 1 - 146
Target Start/End: Complemental strand, 40175416 - 40175271
Alignment:
| Q |
1 |
ttcataatgccttcggtgcctattcaacttcttcttcttaaccatttggttccttttttcaacaattttcataatggatcttcttctcatcgtttgaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40175416 |
ttcataatgccttcggtgcctattcaacttcttcttcttaaccatttggttccttttttcaacaattttcataatggatcttcttctcatcgtttgaaac |
40175317 |
T |
|
| Q |
101 |
ctcttgaaaaaagtgatagacgtggtaatcttagttaacatcaaca |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40175316 |
ctcttgaaaaaagtgatagacgtggtaatcttagttaacatcaaca |
40175271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 75 - 139
Target Start/End: Original strand, 29397254 - 29397318
Alignment:
| Q |
75 |
tggatcttcttctcatcgtttgaaacctcttgaaaaaagtgatagacgtggtaatcttagttaac |
139 |
Q |
| |
|
||||||||||| ||||||||| |||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29397254 |
tggatcttcttttcatcgttttaaacatcttgaaaaaagtgataggcgtggtaatcttagttaac |
29397318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University