View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17478_high_12 (Length: 238)
Name: NF17478_high_12
Description: NF17478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17478_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 92 - 201
Target Start/End: Original strand, 33994413 - 33994521
Alignment:
| Q |
92 |
tcccatagtgaccggtactttatttttgcatgcaaagctatatttgaaatgtcaagccttttctattttagtttctaatcannnnnnngtaatcgaatga |
191 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33994413 |
tcccatagtgactggtactttattta-gcatgcaaagctatatttggaatgtcaagccttttctattttagtttctaatcatttttttgtaatcgaatga |
33994511 |
T |
 |
| Q |
192 |
tgtagtcact |
201 |
Q |
| |
|
|||||||||| |
|
|
| T |
33994512 |
tgtagtcact |
33994521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 33994288 - 33994380
Alignment:
| Q |
1 |
ttatacatgttggacttagttgtataagcatatgagcaacaatagagttatcactaggtcccctcnnnnnnncaaaatagagttgtcaatatc |
93 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
33994288 |
ttatatatgttggacttagtagtataagcatatgagcaacaatagagttatcactaggtcccctcaaaaaaacaaaatagagttgtcactatc |
33994380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University