View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17478_high_13 (Length: 234)
Name: NF17478_high_13
Description: NF17478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17478_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 46 - 215
Target Start/End: Complemental strand, 26399380 - 26399211
Alignment:
| Q |
46 |
tcaacctaatctccatgcaacccatgctccacaattcatcctttacatccatgactctcttgttgtcattcacgnnnnnnnnctttctttcaaaagttaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
26399380 |
tcaacctaatctccatgcaacccatgctccacaattcatcctttacatccatgactctcttgttgtcattcacgttatttttttttctttccaaagttaa |
26399281 |
T |
|
| Q |
146 |
attaagctatgttattttgcacctttgtctgaattattgagtatattatggaggatgatgcaataaagtt |
215 |
Q |
| |
|
||||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26399280 |
attaagctatgttattttgcacctttggtttaattgttgagtatattatggaggatgatgcaataaagtt |
26399211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University