View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17478_high_9 (Length: 295)
Name: NF17478_high_9
Description: NF17478
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17478_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 11 - 277
Target Start/End: Complemental strand, 54105756 - 54105490
Alignment:
| Q |
11 |
gaagaaggaaaagaagtgatacccctcctcatcccatacaacatgggaaaattcaatctgtcccacaggtaaataatttatttagtgcttcatcacattg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54105756 |
gaagaaggaaaagaagtgatacccctcctcatcccatacaacatgggaaaattcaatctgtcccacaggtaaataatttatttagtgcttcatcacattg |
54105657 |
T |
|
| Q |
111 |
aactttgttctaatttcttgattaattcatttttgtgtgtgtcttattaggatagtcctggcacctttaacaagaacaaggtcattcaatttcgtggctc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
54105656 |
aactttgttctaatttcttgattaattcatttttgtgtgtgtcttattaggatagtcctggcaccattaacaagaacaaggtcattcaatttcgtggctc |
54105557 |
T |
|
| Q |
211 |
aaccacatgctgctctttattattctcaacgaacaacaaagggtggcttcttgattggggaagcctc |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54105556 |
aaccacatgctgctctttattattctcaacgaacaacaaagggtggcttcttgattggggaagcctc |
54105490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University