View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17479_low_3 (Length: 298)
Name: NF17479_low_3
Description: NF17479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17479_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 19 - 288
Target Start/End: Complemental strand, 51993072 - 51992796
Alignment:
| Q |
19 |
gttggctcgatgatattttcacggccatcatttgttccaccttgctatcattccattgacatagagaaagaactcttcttgagtcatg----tatgtctt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
51993072 |
gttggctcgatgatattttcacggccatcatttgttccaccttgctatcattccattgacatagagaaagaactcttcttgagtcatgcatgtatgtctt |
51992973 |
T |
|
| Q |
115 |
ctactctgctgaagtttggattctaaaatgtaaaatgttttgtttttcataatagtttccctcgttgattg---gtagatatgtttcatgttgaatttta |
211 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
51992972 |
ctactctgctgaagtttgaattctaaaatgtaaaatgttttgttttttataatagtttcccttgttgattgctggtagatatgtttcatgttgaatttta |
51992873 |
T |
|
| Q |
212 |
gatttattacattgtaagaagagatttattttagaactgacatggtacttttcagggtagtacactgtacacctatg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51992872 |
gatttattacattgtaagaagagatttattttagaactgacatggtacttttcagggtagtacactgtacacctatg |
51992796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University