View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1747_high_18 (Length: 215)

Name: NF1747_high_18
Description: NF1747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1747_high_18
NF1747_high_18
[»] chr2 (1 HSPs)
chr2 (13-197)||(4625988-4626172)


Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 13 - 197
Target Start/End: Original strand, 4625988 - 4626172
Alignment:
13 gtagcaaaggtgcagaaggctttcatggagtttgcagaagctagtggatatccaatagctgtaatgccctccggtaaaggacttgtaccagaaaatcatc 112  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4625988 gtagcaaaggcgcagaaggctttcatggagtttgcagaagctagtggatatccaatagctgtaatgccctccggtaaaggacttgtaccagaaaatcatc 4626087  T
113 cacatttcattggaacatattggggtgctgttagtactagctattgtggggagatagtggagtctgctgatgcttatgtttttgt 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4626088 cacatttcattggaacatattggggtgctgttagtactagctattgtggggagatagtggagtctgctgatgcttatgtttttgt 4626172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University