View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1747_high_9 (Length: 296)
Name: NF1747_high_9
Description: NF1747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1747_high_9 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 4 - 296
Target Start/End: Complemental strand, 5885507 - 5885198
Alignment:
| Q |
4 |
gtgcgtatacaatattcttcgtgtatcacttcaaattttctcgcgcttttcttttcctcccaaaattaaaatcaat-----------------gaagatc |
86 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5885507 |
gtgcgtatacaattttcttcgtgtaccacttcaaattttctcgcgcttttcttttcctcccaaaattaaaatcaatcaagagccggaagcaatgaagatc |
5885408 |
T |
|
| Q |
87 |
gatggagcatgcggtggagatgcttgggatcgacaacaattcattgtgttgcatgagaggcccgagcaaagagggctaacgtccattaccaatggcataa |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5885407 |
gatggagcatgcggtggagatgcttgggatcaacaacagttcattgtgttgcatgagaggcccgagcaaagagggctaacgtccattaccaatggcataa |
5885308 |
T |
|
| Q |
187 |
ggttatttattgtgataacttctcctagtgcagaactatcttttatgtttgatttttaataagttaatttataccaatcatttgaacaattgattttaat |
286 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5885307 |
ggttatttattgtgataacttctcccagtgcagaactatcttttatgttttatttttaataagttaatttataccaatcatttgaacaattgattttaat |
5885208 |
T |
|
| Q |
287 |
gcagtattat |
296 |
Q |
| |
|
||||| |||| |
|
|
| T |
5885207 |
gcagtgttat |
5885198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University