View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1747_low_18 (Length: 249)
Name: NF1747_low_18
Description: NF1747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1747_low_18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 24187149 - 24187386
Alignment:
| Q |
12 |
atgaactgaaggatgatgaattgtatatttgtataatattgcatatactagtannnnnnngctacaaaatattttatagttgctaatcacaatactaaaa |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24187149 |
atgaactgaaggatgatgaattgtatatttgtataatattgcatatactggtatttttttgctacaaaatattttatagttgctaatcacaatactaaaa |
24187248 |
T |
|
| Q |
112 |
tcataagttagaaccctgatgtgatttgagtaacttggttagagattataatattatcttcttaatgcaaaaattatcatgaacatcaaatccgacacat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24187249 |
tcataagttagaaccctgatgtgatttgagtaacttggttagagattataatattatcttcttaatgcaaaaattatcatgaaaatcaaatccgacacat |
24187348 |
T |
|
| Q |
212 |
gtgacatacacaatgcgacaaattatgatacatttaca |
249 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24187349 |
gtgatatacacaatgcgacaaattatgatacatttaca |
24187386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University