View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1747_low_21 (Length: 218)

Name: NF1747_low_21
Description: NF1747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1747_low_21
NF1747_low_21
[»] chr4 (1 HSPs)
chr4 (6-215)||(48491766-48491975)


Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 6 - 215
Target Start/End: Original strand, 48491766 - 48491975
Alignment:
6 gattcaacaagtagttcattgaactcgatacaacgtacagttaatctaataaacaagtcgaactgatggagcagttagtgggcttgaattgattcaaact 105  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48491766 gattcaacaagtagttcattgaactcgatacaacgtacaattaatctaataaacaagtcgaactgatggagcagttagtgggcttgaattgattcaaact 48491865  T
106 tcagtagaaaaataatgttcatgtcaaacttgagtccgagcaggacaaattcttatcaaataaagtcgagctgaagcaagttttgactcaaatggactaa 205  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48491866 tgagtagaaaaataatgttcatgtcaaacttgagtccgagcaggacaaattcttatcaaataaagtcgagctgaagcaagttttgactcaaatggactaa 48491965  T
206 tttcaatgat 215  Q
    |||| |||||    
48491966 tttccatgat 48491975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University