View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1747_low_22 (Length: 215)
Name: NF1747_low_22
Description: NF1747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1747_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 13 - 197
Target Start/End: Original strand, 4625988 - 4626172
Alignment:
| Q |
13 |
gtagcaaaggtgcagaaggctttcatggagtttgcagaagctagtggatatccaatagctgtaatgccctccggtaaaggacttgtaccagaaaatcatc |
112 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4625988 |
gtagcaaaggcgcagaaggctttcatggagtttgcagaagctagtggatatccaatagctgtaatgccctccggtaaaggacttgtaccagaaaatcatc |
4626087 |
T |
 |
| Q |
113 |
cacatttcattggaacatattggggtgctgttagtactagctattgtggggagatagtggagtctgctgatgcttatgtttttgt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4626088 |
cacatttcattggaacatattggggtgctgttagtactagctattgtggggagatagtggagtctgctgatgcttatgtttttgt |
4626172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University