View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1747_low_23 (Length: 210)
Name: NF1747_low_23
Description: NF1747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1747_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 16 - 197
Target Start/End: Complemental strand, 46125923 - 46125745
Alignment:
| Q |
16 |
gcaacaacattatctttttgaattatgtactcaggcaagcaccattatttatttataatacttataaagtactattagcttcgaaaattaacaatgtttg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
46125923 |
gcaacaacattatctttttgaattatgtactcaggcaagcaccattatttatttataatacttataaagta---ttagcttcgaaaataaacaatgtttg |
46125827 |
T |
|
| Q |
116 |
gtgtccatgttttaagaaagggactagactcacaaaacatgcaacatgtgacctgagagatatgtccgacgtatttttagta |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46125826 |
gtgtccatgttttaagaaagggactagactcacaaaacgtgcaacatgtgacctgagagatatgtccgacgtatttttagta |
46125745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University