View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1747_low_9 (Length: 320)
Name: NF1747_low_9
Description: NF1747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1747_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 17 - 305
Target Start/End: Original strand, 45366338 - 45366627
Alignment:
| Q |
17 |
aaaaagaccactgccttggaagctgttgggcttttccatatacttcgaaacacaaaagcctccaaaaaggcaagattgacctcgttcagcgtcaatgtaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45366338 |
aaaaagaccactgccttggaagctgttgggcttttccatatacttcgaaacacaaaagcctccaaaaaggcaagattgacctcgttcagcgtcaatgtaa |
45366437 |
T |
 |
| Q |
117 |
tgtaactaaaaaagaatatgccggtttaacctagaaagaaccttcactatagagtagtgcagacccacaaatcttccttcattaacaaacttggtgaggc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45366438 |
tgtaactaaaaaagaatatgccggtttaacctagaaagaaccttcactatagagtagtgcagacccacaaatcttccttcattaacaaacttggcgaggc |
45366537 |
T |
 |
| Q |
217 |
aacgtcgtcaatacccccgcctctcactcacaca-acctcttttgccagagaaatttccacctccacccactaaattccctcacccccat |
305 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45366538 |
aacgtcgtcaataaccccgcctctcactcacacacacctcttttgccagagaaatttccacctccacccactaaattccctcacccccat |
45366627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University