View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17482_high_1 (Length: 324)
Name: NF17482_high_1
Description: NF17482
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17482_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 141 - 309
Target Start/End: Original strand, 41965545 - 41965713
Alignment:
| Q |
141 |
aatatattttcaaaccttgttacaccacgatatattgatgttctttggccaaaggtatccaaagctcttctaggtgttgcagctgcttcaacgatattat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41965545 |
aatatattttcaaaccttgttacaccacgatatattgatgttctttggccaaaggtatccaaagctcttctaggtgttgcagctgcttcaacgatattat |
41965644 |
T |
 |
| Q |
241 |
tatcacatgtggaatccttagtagtaccacttcccattgataatgtcaatgactgcagattattgttag |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41965645 |
tatcacatgtggaatccttagtagtaccacttcccattgataatgtcaatgactgcagattattgttag |
41965713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 1 - 113
Target Start/End: Original strand, 41965342 - 41965454
Alignment:
| Q |
1 |
ataaaagcaaattaaaataaatcacaacattgatgtatgtctaatgcgatttatggtgaaacacggttgccattactaacatgattttttcgacgaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41965342 |
ataaaagcaaattaaaataaatcacaacattgatgtatgtctaatgcgatttatggtgaaacacggttgccattactaacatgattttttcgacgaattc |
41965441 |
T |
 |
| Q |
101 |
tacttaagccaga |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41965442 |
tacttaagccaga |
41965454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 109 - 138
Target Start/End: Original strand, 41965522 - 41965551
Alignment:
| Q |
109 |
ccagacatgcaaaaaatttaaacaatatat |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41965522 |
ccagacatgcaaaaaatttaaacaatatat |
41965551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University