View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17484_high_13 (Length: 324)
Name: NF17484_high_13
Description: NF17484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17484_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 130 - 298
Target Start/End: Original strand, 40746468 - 40746636
Alignment:
| Q |
130 |
cactcattacatgacatttgactcccaaccttatactactcttgcagacggttctcatattcaacattcaatctttttaattgaaagatgtgatttatgt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40746468 |
cactcattacatgacatttgactcccaaccttatactactcttgcagacggttctcatattcaacattcaatctttttaattgaaagatgtgatttatgt |
40746567 |
T |
|
| Q |
230 |
ttgtctttagaaaaatcttatctcgacttacaatcttacaaaggctaataattgtgtagtaatattttt |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40746568 |
ttgtctttagaaaaatcttatctcgacttacaatcttacaaaggctgataattgtgtagtaatattttt |
40746636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 36 - 132
Target Start/End: Original strand, 40746076 - 40746172
Alignment:
| Q |
36 |
tttagtcctttgctgcatttgtttgcggtttatttgtggcaaccttaatcatatattgtttttgggttgtatcatcctctgttgcaactatatccac |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40746076 |
tttagtcctttgctgcatttgtttgcggtttatttgtggcaaccttaatcatatattgtttttgggttgtatcatcctcagttgcaactatatccac |
40746172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University