View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17484_high_17 (Length: 267)

Name: NF17484_high_17
Description: NF17484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17484_high_17
NF17484_high_17
[»] chr8 (2 HSPs)
chr8 (1-90)||(9247739-9247828)
chr8 (158-229)||(9247600-9247671)


Alignment Details
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 9247828 - 9247739
Alignment:
1 attacatgcattttgcaacataagaagaaacaaaattagtttgtcagatgtgtggctgcaatgacagattgtccttgattgatcacgagg 90  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||    
9247828 attacatgcattttgcaacataagaagaaacaaaattagtttgtcagatgcgtggctgcaatgacagattgtccttgattgatcatgagg 9247739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 158 - 229
Target Start/End: Complemental strand, 9247671 - 9247600
Alignment:
158 accgtctttaaatgatgcagtgtgaaggtgtttggagtttctgcaaagtcaatgcagtgttcttatgatgat 229  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
9247671 accgtctttaaatgatgcagtgtgaaggtatttggagtttctgcaaagtcaatgcagtgttcttatgatgat 9247600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University