View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17484_high_21 (Length: 228)
Name: NF17484_high_21
Description: NF17484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17484_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 59 - 212
Target Start/End: Original strand, 10360783 - 10360936
Alignment:
| Q |
59 |
atcatttatgtgtatatctaaatacttttgatttaaagttgtatcaaactaaatatttctcacaaacaatatagacaatagaaacaacaatagtagaaga |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||||| |||||||| |
|
|
| T |
10360783 |
atcatttatgtgtatatctaaatacttttgatttaaagttgtatctaactaaatatttctcacaaataatatagacaacagaaacaacaatggtagaaga |
10360882 |
T |
 |
| Q |
159 |
aagagtgttcaaaggagtgtgacccaaaaccagagagatatattgacttttttg |
212 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10360883 |
aagagtattcaaaggagtgtgacccaaaaccagagagatatattgacttttttg |
10360936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University