View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17484_low_26 (Length: 224)
Name: NF17484_low_26
Description: NF17484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17484_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 41852852 - 41852645
Alignment:
| Q |
1 |
ttagaagttatagcaacttttactctacaaaatgtacccaaaatgcataaccagtcaaaaagtatataccctatgtatatatctcatagcagtcaaacct |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41852852 |
ttagaagttatagcaacttttactctaaaaaatgtacccaaaatgcataaccagtcaaaaagtatataccctatgtatatatctccaagcagtcaaacct |
41852753 |
T |
 |
| Q |
101 |
aatcctcggtcaggcatcaccacgccgctctctctgttctctttcttcatcttcttcagctagttttgccagctcttgctgaataatagtctttacagac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41852752 |
aatcctcggtcaggcatcaccacgccgctctctctgttctctttcttcatcttcttcagctagttttgccagctcttgctgaataatagtctttacagat |
41852653 |
T |
 |
| Q |
201 |
gcctttct |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
41852652 |
gcctttct |
41852645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University