View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17484_low_27 (Length: 219)
Name: NF17484_low_27
Description: NF17484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17484_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 3e-35; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 38089765 - 38089666
Alignment:
| Q |
1 |
tgaatagttgcaagagctgatttgcacttatggattggatcagtgtggccttgtgccacagccacggttgctgccatccaaacacggttcaagtaactca |
100 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
38089765 |
tgaatagttccaagagctgttttgcacttatagattggatcagtgtggccttgtgccaccgccactgttgctgccatccaaacacggttcaaataactca |
38089666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 38092748 - 38092649
Alignment:
| Q |
1 |
tgaatagttgcaagagctgatttgcacttatggattggatcagtgtggccttgtgccacagccacggttgctgccatccaaacacggttcaagtaactca |
100 |
Q |
| |
|
||||||||| | |||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
38092748 |
tgaatagttcccagagctgatttgcagttatggattggttcagtgtggccttgtgccacagccatggttgctgccatccaaacacggttcatgtaactca |
38092649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 141 - 219
Target Start/End: Complemental strand, 38092604 - 38092526
Alignment:
| Q |
141 |
gcctaacaaacagtaggaaagtgtttgatgagttacatgataagaggaatgaggtatttataaaggaatgaggaccatt |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
38092604 |
gcctaaaaaacagtaggaaagtgtttgatgagttagctgataagagaaatgaggtatttataatggaatgagaaccatt |
38092526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 38096013 - 38095929
Alignment:
| Q |
16 |
gctgatttgcacttatggattggatcagtgtggccttgtgccacagccacggttgctgccatccaaacacggttcaagtaactca |
100 |
Q |
| |
|
|||| ||||||||| ||| |||||| ||||||||||| ||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096013 |
gctgttttgcacttgtggcctggatcggtgtggccttgcgccaccgctacggttgctgccatccaaacacggttcaagtaactca |
38095929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University