View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17487_high_21 (Length: 302)
Name: NF17487_high_21
Description: NF17487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17487_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 7e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 166 - 285
Target Start/End: Original strand, 24942002 - 24942118
Alignment:
| Q |
166 |
aggtgtttgtttgagtacgtatagagacttggatgagtcactatgtgagttttagaggaaagttacttcaaaaacgcatatgagcatattgacatatgtt |
265 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
24942002 |
aggtgtttgtttgag---gtatagagacttggatgtgtcactatgtgagttttagaggaaagttacttccaaaacgcatatgagcatattgatatatgtt |
24942098 |
T |
|
| Q |
266 |
gttctattagttacatgttg |
285 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
24942099 |
gttctattagttacatgttg |
24942118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University