View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17487_low_17 (Length: 384)
Name: NF17487_low_17
Description: NF17487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17487_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 89 - 357
Target Start/End: Original strand, 32325518 - 32325792
Alignment:
| Q |
89 |
attttaaatgttgggtttggggatgtggtggggaaagaaaatcagaagaaagaaatggaattcgttcttccaactccaagggataatcgtgcatgcatgc |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32325518 |
attttaaatgttgggtttggggatgtggtggggaaagaaaatcagaagaaagaaatggaattcgttcttccaactccaagggataatcgtgcatgcatgc |
32325617 |
T |
 |
| Q |
189 |
atggtggatgaggaaagaaaataaggaaagcaacgtttctttccttgtggctttggt------tctgattttttagcttttcattggtgttttcacgacc |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32325618 |
atggtggatgaggaaagaaaataaggaaagcaacgtttctttccttgtggctttggttatgtctatgattttttagctttacattggtgttttcacgacc |
32325717 |
T |
 |
| Q |
283 |
tcgtttggacgtatatttcccactttcatgaggaaaataattttgtttttctataatcaaattaaatctttacac |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32325718 |
tcgtttggacgtatatttcccactttcatgaggaaaataattttgtttttctataatcaaattaaatctttacac |
32325792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University