View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17487_low_23 (Length: 306)
Name: NF17487_low_23
Description: NF17487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17487_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 18 - 139
Target Start/End: Original strand, 49386842 - 49386963
Alignment:
| Q |
18 |
agttatggcacgagtgtccatcaaacagcataagttcacagaaagaaagatatatgttgtcaagccagccaataacccgcgattctattctaaatctaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49386842 |
agttatggcacgagtgtccatcaaacagcataagttcacagaaagaaagatatatgttgtcaagccagccaataacccgcgattctattctaaatctaat |
49386941 |
T |
 |
| Q |
118 |
ctattattattgcttgcactac |
139 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49386942 |
ctattattattgcttgcactac |
49386963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 208 - 292
Target Start/End: Original strand, 49387037 - 49387121
Alignment:
| Q |
208 |
taatatatcatatcatggtaatgaataggaatttttaacaactctatgccacattgttaaaatcctatttcaatttttcacttat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49387037 |
taatatatcatatcatggtaatgaataggaattttgaacaactctatgccacattgttaaaatcctatttcaatttttcacttat |
49387121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University