View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17487_low_29 (Length: 250)
Name: NF17487_low_29
Description: NF17487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17487_low_29 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 36677162 - 36676923
Alignment:
| Q |
11 |
atgaatcaaactcaaaggaccgcatatgctaaaataaaataatagagtgatattgactaaaattgctttgattttatctaacaaccatcattcaattaac |
110 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36677162 |
atgaatcaaacttaaaggaccgcatatgctaaaataaaataatagagtgatattgactaaaattgctttgattttatctaacaaccatcattcaattaac |
36677063 |
T |
|
| Q |
111 |
cgtgtaaagttaatgatctatatacatttaatggaatttcacgtgcaaaaatcactgtccattgttgtatccttgaacaaggcctttataagcccaaaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36677062 |
cgtgtaaagttaatgatctatatacatttaatggaatttcacgtgcaaaaatcactgtccattgttatatccttgaacaaggcctttataagcccaaaaa |
36676963 |
T |
|
| Q |
211 |
tacttaacattttattcatcatcatcttccactttccctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36676962 |
tacttaacattttattcatcatcatcttccactttccctc |
36676923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University