View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17487_low_33 (Length: 238)
Name: NF17487_low_33
Description: NF17487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17487_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 3 - 90
Target Start/End: Original strand, 413301 - 413388
Alignment:
| Q |
3 |
atccatccattaggaatatatgcaccacatgggttggagttttctttgtggtaaaagaatgctattcagtttaggtcaattagataaa |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
413301 |
atccatccattaggaatatatgcaccacatgggttggagttttctttgtggtaaaagaatgctatttagtttatgtcaattagataaa |
413388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 175 - 221
Target Start/End: Original strand, 417754 - 417800
Alignment:
| Q |
175 |
caattttgtttcgggatgaaatcgtgagaatttctatcgcttgaaat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
417754 |
caattttgtttcgggatgaaatcgtgagaatttatatcgcttgaaat |
417800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 176 - 221
Target Start/End: Original strand, 11741752 - 11741797
Alignment:
| Q |
176 |
aattttgtttcgggatgaaatcgtgagaatttctatcgcttgaaat |
221 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
11741752 |
aattttgtttcgggatcaaatcgtgagaatttctgtcgcttgaaat |
11741797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University